Hello and welcome to this educational game!
Before we begin, we would like to note that this game is about cancer. Besides the theoretical knowledge discussed in your book, some information about the diagnosis, treatment, and prevention of cancer will be discussed. To people who might have experience with cancer, whether that be themselves or someone close to them, it might cause emotional discomfort. We do, however, advise you to give it a try, as it is important to learn about cancer despite it being a terrible disease.
[[Got it!]]
In this seminar you will follow Eva, she is a fictive patient with symptoms that indicate possible tumor growth. Eva has visited an oncologist in order to confirm this and to look for possible treatments. It is up to you to help Eva and her doctor beat this awful disease. While doing this you will gain more knowledge on tumors, metastasis, as well as cancer in general.
This entire game will be in English. For fill-in questions, please also answer in English and lowercase. If possible, answer with one word only.
[[Let’s start!]]
Our protagonist is called Eva. She is a lawyer with a passion for horseback riding and Zumba. A lovely lady according to her friends and family. Last week, she turned fifty! So a big party was thrown for her. But along with lots of presents and nice cards, she also found a letter from the government in her mailbox. Eva has received an invitation for the national breast cancer screening program. Just to be safe, she takes it on and has a [[mammography]] done. Unfortunately, an abnormality in the mammograph was found and she was referred to the hospital for further research.
After listening to Eva’s story, the doctor at the hospital decides to carry out a [[PET-CT scan]] to gain a better insight on the anomaly. Eva is advised to fast for a few hours prior to the scan. The doctor also makes her drink a cocktail with fluorodeoxyglucose, a radiolabeled glucose. This radioactive substance will be visible on the PET-CT scan. The final image of the scan results is shown below.^^1^^
<img src=https://www.researchgate.net/profile/Jens-De-Vos/publication/233918959/figure/fig1/AS:299954066214917@1448526030639/PET-CT-scan-of-a-patient-with-breast-cancer-A-trace-amount-of-radiolabeled-glucose-18.png>
(text-style:"italic","subscript")+ (text-color: gray)[CT scan of the patient.^^1^^]
Why does fluorodeoxyglucose have to be administered in order to see if Eva has cancer?
1. [[Fluorodeoxyglucose binds the receptors of the cancer cells, which makes them visible on the scan. -> option1.1]]
2. [[Fluorodeoxyglucose is absorbed into the cancer cells due to their increased metabolism, this makes them visible on the scan. -> option1.2]]
3. [[Fluorodeoxyglucose is rejected by regular cells, but not by cancer cells. -> option1.3]]
4. [[Fluorodeoxyglucose is rejected by cancer cells, but not by regular cells. -> option1.4]]
When you receive a mammography, an x-ray scan will be made of your breast. Tumors and other breast-associated diseases can be detected using this scan.
For more information, (link: "click here!")[(open-url: 'https://www.nibib.nih.gov/science-education/science-topics/mammography')]
[[Go back ->Let’s start!]]
A PET-CT scan is a combination of a positron emission tomography (PET) scan and a computer tomography (CT) scan. Using a radioactive substance, tissues can be visualized in the scan. Combining the two scans using a computer will enhance the results.
For more information, (link: "click here!")[(open-url: 'https://www.umcg.nl/-/pet-scan')]
[[Go back ->Let’s start!]]
This is incorrect.
Fluorodeoxyglucose enters cancer cells and regular cells similar to glucose.
[[Try again! ->Let’s start!]] This is correct!
Cancer cells do indeed have an increased metabolism, this is because they need more energy to keep up with their extreme growth and divisions. The phenomenon in which cancer cells absorb more glucose and produce lactate is called the (input-box:2bind $effect,"=XX=",1)
Please use all lowercase.
[[Check your answer ->check answer 1]]This is incorrect.
Fluorodeoxyglucose enters cancer cells and regular cells similar to glucose.
[[Try again! ->Let’s start!]] This is incorrect.
Fluorodeoxyglucose enters cancer cells and regular cells similar to glucose.
[[Try again! ->Let’s start!]] (if: $effect is 'warburg effect')[This is why the cancer cells absorb more radiolabeled glucose than regular cells. To prevent excessive fluorodeoxyglucose uptake by regular cells, patients are advised to move as little as possible so the body doesn’t need to use any glucose to provide energy. Thus, fluorodeoxyglucose accumulation can visualize the location of cancer cells.
That is correct, [[let's move on! -> Fluorodeoxyglucose in tissues]]]
(else:)[ This is incorrect, let's [[try again -> option1.2]] (set: $warburg to it +1)
(if: $warburg is 5 or 6 or 7 or 8)[If you've tried but couldn't find the answer, you can [[skip-> Fluorodeoxyglucose in tissues]] this question. The correct answer was (text-colour:#ffadff)[warburg effect].
This is why the cancer cells absorb more radiolabeled glucose than regular cells. To prevent excessive fluorodeoxyglucose uptake by regular cells, patients are advised to move as little as possible so the body doesn’t need to use any glucose to provide energy. Thus, fluorodeoxyglucose accumulation can visualize the location of cancer cells.]
Hint: Read page 1175 in Molecular Biology of the Cell 7th edition]
<img src=https://www.researchgate.net/profile/Jens-De-Vos/publication/233918959/figure/fig1/AS:299954066214917@1448526030639/PET-CT-scan-of-a-patient-with-breast-cancer-A-trace-amount-of-radiolabeled-glucose-18.png>
(text-style:"italic","subscript") + (text-color: gray)[CT scan of the patient.^^1^^]
Which tissues are visible on the scan after administering fluorodeoxyglucose?
[(set: $visiblebrain to false)(set: $visiblestomach to false)(set: $visiblekidneys to false)(set: $visiblebladder to false)(set: $visiblebreast to false)(set: $visiblelungs to false)(set: $visibleliver to false)(set: $visibleovaries to false)]
(checkbox: 2bind $visiblebrain, "Brain")
(checkbox: 2bind $visiblestomach, "Stomach")
(checkbox: 2bind $visiblekidneys, "Kidneys")
(checkbox: 2bind $visiblebladder, "Bladder")
(checkbox: 2bind $visiblebreast, "Breast" )
(checkbox: 2bind $visiblelungs, "Lungs")
(checkbox: 2bind $visibleliver, "Liver")
(checkbox: 2bind $visibleovaries, "Ovaries")
[[Check answer -> Check answer 2]](if: $visiblebrain is true and $visiblestomach is false and $visiblekidneys is true and $visiblebladder is true and $visiblebreast is true and $visiblelungs is false and $visibleliver is false and $visibleovaries is false) [This is correct! These tissues are all colored on the scan. An abnormal signal is visible in Eva’s left breast. It seems likely that Eva has a form of breast cancer.
[[Next question ->Brain fluorodeoxyglucose signal]]]
(else:)[This is incorrect. Hint: There are 4 correct answers.
[[Try again -> Fluorodeoxyglucose in tissues]](set: $tissues to it +1)
(if: $tissues is 5 or 6 or 7 or 8) [If you've tried but couldn't find the answer, you can [[skip->Brain fluorodeoxyglucose signal]] this question. The correct answers were (text-colour:#ffadff)[Brain, Kidneys, Bladder] and (text-colour:#ffadff)[Breast].
These tissues are all colored on the scan. An abnormal signal is visible in Eva’s left breast. It seems likely that Eva has a form of breast cancer.]]
<img src=https://www.researchgate.net/profile/Jens-De-Vos/publication/233918959/figure/fig1/AS:299954066214917@1448526030639/PET-CT-scan-of-a-patient-with-breast-cancer-A-trace-amount-of-radiolabeled-glucose-18.png>
(text-style:"italic","subscript")+ (text-color: gray)[CT scan of the patient.^^1^^]
So, there is more than one signal visible in the image^^1^^. Aside from the spot in the breast, the kidneys, brain, and bladder also showcase fluorodeoxyglucose accumulation. Why could there be a signal in the brain?
1. [[The brain has a blood-brain barrier in which the fluorodeoxyglucose remains stuck. -> option2.1]]
2. [[There is also a tumor in the brain, just like in the breast. -> option2.2]]
3. [[The brain absorbs the fluorodeoxyglucose because it is an organ that uses a lot of glucose. -> option2.3]]
This is incorrect.
Hint: Not only cancer cells absorb fluorodeoxyglucose.
[[Try again! ->Brain fluorodeoxyglucose signal]] This is incorrect.
Hint: Not only cancer cells absorb fluorodeoxyglucose.
[[Try again! ->Brain fluorodeoxyglucose signal]] This is correct!
The brain uses a lot of glucose. Despite Eva limiting her movement before the scan, her brain will still use up a lot of glucose, including the fluorodeoxyglucose. The localization of fluorodeoxyglucose in the kidneys, brain, and bladder, as seen in the image, is a normal result for a PET-CT scan. Fluorodeoxyglucose is present in the kidneys and bladder because it gets disposed of via urine. In order to study cancer cells in the previously named organs, different labeling methods are used.
[[To the next question! -> Mutations needed for cancer development]]
We now know that it's highly likely for Eva to have a tumor. Before we start the treatment, it is important to have a good understanding of the development of a tumor from a regular cell.
A healthy cell can change into a tumor cell when mutations occur. How many mutations are needed for this to happen?
1. [[1 -> option3.1]]
2. [[2 or 3 -> option3.2]]
3. [[3, 4 or 5 -> option3.3]]
This is incorrect.
[[Let's try again! -> Mutations needed for cancer development]] This is incorrect.
[[Let's try again! -> Mutations needed for cancer development]] This is correct!
Multiple mutations are necessary to change a healthy cell into a tumor cell. Additional mutations are necessary to change a benign tumor into an invasive cancer cell. The mutations in a cancer cell will only increase after becoming a cancer cell because of their genomic instability.
<img src= "https://www.facingourrisk.org/uploads/cell-damage-and-cancer2.JPG", width= 500 />
(text-style:"italic","subscript")+ (text-color: gray)[Mutations needed for cancer development.^^13^^]
[[Let's move on. -> Driver and passenger mutations]]The mutations that are present in a cancer cell are not always crucial for cancer development. Thus, the mutation can be divided into two groups: the cancer-critical, or [(dropdown: bind $mutation1,"-", "passive","passenger","agressive","driver")], mutations, and the cancer non-critical, or (dropdown: bind $mutation2,"-", "passive","passenger","agressive","driver"), mutations.
[[Check answer -> check answer 3]]
(if: $mutation1 is 'driver' and $mutation2 is 'passenger')[Yes, those are the right answers!
A few examples of these mutations are put down below. Click on one to do the exercises for each example.
- [[CFTR gene]]
- [[Rb pathway]]
- [[Ras pathway]]
- [[P53 pathway]]]
(else:) [That is not quite right, [[let's try once more. -> Driver and passenger mutations]]]
(if: $mutationsC is 1 and $mutationsR is 1 and $mutationsA is 1 and $mutationsP is 1)[You've completed all exercises, well done!
Figure 20.29 in Molecular Biology of the Cell 7^^th^^ edition visualises the three most important pathways associated with cancer development, which are influenced by the Rb, Ras and P53 pathways. It must be said that there can be overlap between these properties, as is the case with Ras. The GTPase plays a role in multiple pathways, some of which also influence the cell cycle and cell survival.
[[Let's move on! -> Cell division and apoptosis]]]The CFTR gene codes for the CFTR protein, a Cl- transport protein in the plasma membrane in epithelial cells. It is a member of the ABC transporter family.
A mutation in the CFTR gene is a (dropdown: bind $CFTR,"-","passenger","driver") mutation.
[[Check your answer -> check answer 4.1]]<img src= "https://www.researchgate.net/publication/277729355/figure/fig5/AS:668777150681108@1536460306731/General-Rb-E2F-pathway-whereby-E2F-activity-is-controlled-by-the-phosphorylation-state-of.png" />
(text-style:"italic","subscript")+ (text-color: gray)[General Retinoblastoma pathway.^^14^^]
Retinoblastoma (Rb) is a regulatory protein that regulates the G1 checkpoint. If the Rb protein is active, it binds to the regulatory protein E2F, which is a transcription factor. But if the Rb protein is inactive, the E2F genes can be transcribed and the cell can enter the S-phase.
A mutation in the Rb pathway that causes the Rb protein to be permanently inactivated is a (dropdown: bind $Rb1,"-","passenger","driver") mutation. It affects the (dropdown: bind $Rb2,"-","cell cycle","cell proliferation", "cell survival"), this way the cell replication is sped up.
[[Check your answer -> check answer 4.2]]
<img src= "https://cdn.technologynetworks.com/tn/images/body/35374_cellsignaling_080421_la-v41618572674199.png" , width = 500/>
(text-style:"italic","subscript")+ (text-color: gray)[An overview of the Ras-Raf-MEK-ERK cascade.^^15^^]
Ras is a monomeric GTPase involved in many signaling pathways, such as cell differentiation pathways.
A mutation which blocks the hydrolyzation of the GTP in Ras is a (dropdown: bind $Ras1,"-","passenger","driver") mutation. It affects the (dropdown: bind $Ras2,"-","cell cycle","cell proliferation", "cell survival") by upregulating signal cascades that dive cell growth.
[[Check your answer -> check answer 4.3]]
<img src="https://www.ncbi.nlm.nih.gov/pmc/articles/instance/3660384/bin/pone.0065044.g008.jpg" , width = 500 />
(text-style:"italic","subscript")+ (text-color: gray)[The role of p53 as a result of DNA damage.^^16^^]
p53 is a protein that is activated when DNA damage occurs. If p53 is activated, the p21 gene can be transcribed and the cell cycle will be put on pause in order to repair the damages.
A mutation in the p53 pathway, which permanently inactivates p53, is a (dropdown: bind $p531,"-","passenger","driver") mutation. It affects the (dropdown: bind $p532,"-","cell cycle","cell proliferation", "cell survival"). This can result in the development of a tumor cell.
[[Check your answer -> check answer 4.4]]
(if: $CFTR is 'passenger') [That is correct!
This mutation causes cystic fibrosis and it has no influence on cancer development.
(set: $mutationsC to 1)
[[Next mutation -> check answer 3]] ]
(else:) [That's incorrect, [[try again! ->CFTR gene]] ]
(if: $Rb1 is 'driver' and $Rb2 is 'cell cycle') [Those answers are correct!
(set: $mutationsR to 1)
[[Next mutation -> check answer 3]] ]
(else:) [That's incorrect, [[try again! ->Rb pathway]] ](if: $Ras1 is 'driver' and $Ras2 is 'cell proliferation') [Those answers are correct!
(set: $mutationsA to 1)
[[Next mutation -> check answer 3]] ]
(else:) [That's incorrect, [[try again! ->Ras pathway]] ](if: $p531 is 'driver' and $p532 is 'cell survival')[Those answers are correct!
(set: $mutationsP to 1)
[[Next mutation -> check answer 3]]]
(else:) [That's incorrect, [[try again! ->P53 pathway]] ]The driver mutations in cancer cells result in an abnormal phenotype when compared to regular cells. Fill in the missing words.
Normal cell division and normal apoptosis leads to homeostatis.
Normal apoptosis and (dropdown: bind $apoptosis1,"-", "increased","decreased") cell division leads to tumor development.
Normal cell division and (dropdown: bind $apoptosis2,"-", "increased","decreased") apoptosis leads to tumor development.
[[Check your answer -> check answer 5]](if: $apoptosis1 is 'increased' and $apoptosis2 is 'decreased')[This is correct!
Figure 20.14 in Molecular Biology of the Cell 7^^th^^ edition visualises the balace between apoptosis and cell division and their relation to tumor development.
[[Next question -> Eva's mutant gene (BLAST)]]]
(else:)[That is not correct. [[try again -> Cell division and apoptosis]] ]To be absolutely sure that Eva has cancer, a sample of the tumor tissue is taken to be examined in a lab. This procedure is called a biopsy. The tissue will then be tested on the presence of biomarkers and mutated genes. The taken sample was shown to be both ER (estrogen) and PR (progesterone) positive, but HER2 negative.
On top of this, the researchers have found an interesting gene in Eva’s DNA that is not quite right. This gene might have one of the causative mutations that lead to Eva’s cancer. The obtained sequence of the found gene can be found down below.
Which gene could this sequence possibly belong to? Tip: Use (link: "BLASTn")[(open-url: 'https://blast.ncbi.nlm.nih.gov/Blast.cgi')] to search for the sequence, and make use of Google to search for the biomarkers. When using BLASTn, ignore the first 4 results. Use captials as used in the BLAST results.
(input-box:2bind $BLAST, 1)
(if: $BLASTresult is 4 or 5 or 6 or 7 or 8) [If you've tried but couldn't find the answer, you can [[skip-> BRCA2 gene mutation]] this question. The correct answer was (text-colour:#ffadff)[BRCA2].]
[[Check your answer -> check answer 6]]
Unknown abnormal gene>
(text-color: #ffadff)[GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCGCC
TCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGG
TTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGGGTTAGTGGTGGTGGTAGTGGGT
TGGGACGAGCGCGTCTTCCGCAGTCCCAGTCCAGCGTGGCGGGGGAGCGCCTCACGCCCCGGGTCGCTGC
CGCGGCTTCTTGCCCTTTTGTCTCTGCCAACCCCCACCCATGCCTGAGAGAAAGGTCCTTGCCCGAAGGC
AGATTTTCGCCAAGCAAATTCGAGCCCCGCCCCTTCCCTGGGTCTCCATTTCCCGCCTCCGGCCCGGCCT
TTGGGCTCCGCCTTCAGCTCAAGACTTAACTTCCCTCCCAGCTGTCCCAGATGACGCCATCTGAAATTTC
TTGGAAACACGATCACTTTAACGGAATATTGCTGTTTTGGGGAAGTGTTTTACAGCTGCTGGGCACGCTG
TATTTGCCTTACTTAAGCCCCTGGTAATTGCTGTATTCCGAAGACATGCTGATGGGAATTACCAGGCGGC
GTTGGTCTCTAACTGGAGCCCTCTGTCCCCACTAGCCACGCGTCACTGGTTAGCGTGATTGAAACTAAAT
CGTATGAAAATCCTCTTCTCTAGTCGCACTAGCCACGTTTCGAGTGCTTAATGTGGCTAGTGGCACCGGT
TTGGACAGCACAGCTGTAAAATGTTCCCATCCTCACAGTAAGCTGTTACCGTTCCAGGAGATGGGACTGA
ATTAGAATTCAAACAAATTTTCCAGCGCTTCTGAGTTTTACCTCAGTCACATAATAAGGAATGCATCCCT
GTGTAAGTGCATTTTGGTCTTCTGTTTTGCAGACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAA
AATGCCTATTGGATCCAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAGCAGGT
ATTGACAAATTTTATATAACTTTATAAATTACACCGAGAAAGTGTTTTCTAAAAAATGCTTGCTAAAAAC
CCAGTACGTCACAGTGTTGCTTAGAACCATAAACTGTTCCTTATGTGTGTATAAATCCAGTTAACAACAT
AATCATCGTTTGCAGGTTAACCACATGATAAATATAGAACGTCTAGTGGATAAAGAGTACCTCCTTTTTT
ATCTTTTACTGTGATTATTCTTCATCTTCCTTCCTTTTCATGTCATTTTATATGTTCTTATGTAAAATTA
CTTTCATCTAGAATAGGAATAATGTGAACTGAAATCACCTAACCTATTAGGAGTTAGGGGAGGGAGACTGTGTGTAATATTTGCGTGCTTAAAT
ATTTTCAATGAAAAGTTACTTTGATTTAGTTTTTTATGTTACTACATAATTATGATAGGCTACGTTTTCA
TTTTTTTATCAGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTTATCACTTTGTATGGCCA
AAAGGAAGTCTGTTTCCACACCTGTCTCAGCCCAGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGAT
TGATGACCAAAAGAACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGACTGCCTTTACCTCCACCT
GTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGCA
CCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTCAA
TGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGAAGAACTTGCATTGATAAATACCCAAGCTCTT
TTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTT
CAGAAGATTATCTCAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCCCAGGC
CAGTACGGAAGAATGTGAGAAAAATAAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCA
AAGGCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACAC
ATTAGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGC
AAAAATCGTTTTGCCCGATTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAA
TTTATTAACTAATCAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTG
AGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATAGGGAGACCCC
CATCTTTACAAAGAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTA
TTATTTTACAAGTGAAATAAACATACCATTTTCTTTTAGATTGTGTCATTAAATGGAATGAGGTCTCTTA
GTACAGTTATTTTGATGCAGATAATTCCTTTTAGTTTAGCTACTATTTTAGGGGATTTTTTTTAGAGGTA
ACTCACTATGAAATAGTTCTCCTTAATGCAAATATGTTGGTTCTGCTATAGTTCCATCCTGTTCAAAAGT
CAGGATGAATATGAAGAGTGGTGTTTCCTTTTGAGCAATTCTTCATCCTTAAGTCAGCATGATTATAAGA
AAAATAGAACCCTCAGTGTAACTCTAATTCCTTTTTACTATTCCAGTGTGATCTCTGAAATTAAATTACT
TCAACTAAAAATTCAAATACTTTAAATCAGAAGATTTCATAGTTAATTTATTTTTTTTTTCAACAAAATG
GTCATCCAAACTCAAACTTGAGAAAATATCTTGCTTTCAAATTGGCACTGATT]
[[Help! I can't do a BLAST right now.]]
Here is one of the top results of a BLASTn using the unknown sequence.
(link: "BLASTn result")[(open-url: 'https://www.ncbi.nlm.nih.gov/nucleotide/AY436640.1?report=genbank&log$=nucltop&blast_rank=4&RID=MW1T5R1301N')]
(if: $extra is 1)[[[Go back. -> BRCA2 gene mutation]]]
(else:)[[[Go back. -> Eva's mutant gene (BLAST)]]] (if: $BLAST is 'BRCA2')[Yes, that is the right gene!
Could this gene possibly be connected to Eva's cancer? And what makes this gene so interesting to researchers? [[Let's examine it! -> BRCA2 gene mutation]]]
(else:)[That is not quite right. Try using both search methods. If you performed a BLASTn, it could help to click on one of your results.
[[Go back. -> Eva's mutant gene (BLAST)]]
(set: $BLASTresult to it +1)]If you chose to use BLASTn for the previous question, you might have noticed that this sequence is not identical to the sequences in your search results. It is obvious that Eva’s BRCA2 gene contains a mutation, but which kind of mutation could it be?
1. [[Deletion-> option4.1]]
2. [[Insertion-> option4.2]]
3. [[Nonsense-> option4.3]]
4. [[Missense-> option4.4]]
5. [[Silent-> option4.5]]
Tip: Use (link: "BLASTn")[(open-url: 'https://blast.ncbi.nlm.nih.gov/Blast.cgi')] to search for the sequence, and make use of Google to search for the biomarkers. When using BLASTn, ignore the first 4 results. (set: $extra to 1)
Unknown abnormal gene>
(text-color: #ffadff)[GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCGCC
TCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGG
TTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGGGTTAGTGGTGGTGGTAGTGGGT
TGGGACGAGCGCGTCTTCCGCAGTCCCAGTCCAGCGTGGCGGGGGAGCGCCTCACGCCCCGGGTCGCTGC
CGCGGCTTCTTGCCCTTTTGTCTCTGCCAACCCCCACCCATGCCTGAGAGAAAGGTCCTTGCCCGAAGGC
AGATTTTCGCCAAGCAAATTCGAGCCCCGCCCCTTCCCTGGGTCTCCATTTCCCGCCTCCGGCCCGGCCT
TTGGGCTCCGCCTTCAGCTCAAGACTTAACTTCCCTCCCAGCTGTCCCAGATGACGCCATCTGAAATTTC
TTGGAAACACGATCACTTTAACGGAATATTGCTGTTTTGGGGAAGTGTTTTACAGCTGCTGGGCACGCTG
TATTTGCCTTACTTAAGCCCCTGGTAATTGCTGTATTCCGAAGACATGCTGATGGGAATTACCAGGCGGC
GTTGGTCTCTAACTGGAGCCCTCTGTCCCCACTAGCCACGCGTCACTGGTTAGCGTGATTGAAACTAAAT
CGTATGAAAATCCTCTTCTCTAGTCGCACTAGCCACGTTTCGAGTGCTTAATGTGGCTAGTGGCACCGGT
TTGGACAGCACAGCTGTAAAATGTTCCCATCCTCACAGTAAGCTGTTACCGTTCCAGGAGATGGGACTGA
ATTAGAATTCAAACAAATTTTCCAGCGCTTCTGAGTTTTACCTCAGTCACATAATAAGGAATGCATCCCT
GTGTAAGTGCATTTTGGTCTTCTGTTTTGCAGACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAA
AATGCCTATTGGATCCAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAGCAGGT
ATTGACAAATTTTATATAACTTTATAAATTACACCGAGAAAGTGTTTTCTAAAAAATGCTTGCTAAAAAC
CCAGTACGTCACAGTGTTGCTTAGAACCATAAACTGTTCCTTATGTGTGTATAAATCCAGTTAACAACAT
AATCATCGTTTGCAGGTTAACCACATGATAAATATAGAACGTCTAGTGGATAAAGAGTACCTCCTTTTTT
ATCTTTTACTGTGATTATTCTTCATCTTCCTTCCTTTTCATGTCATTTTATATGTTCTTATGTAAAATTA
CTTTCATCTAGAATAGGAATAATGTGAACTGAAATCACCTAACCTATTAGGAGTTAGGGGAGGGAGACTGTGTGTAATATTTGCGTGCTTAAAT
ATTTTCAATGAAAAGTTACTTTGATTTAGTTTTTTATGTTACTACATAATTATGATAGGCTACGTTTTCA
TTTTTTTATCAGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTTATCACTTTGTATGGCCA
AAAGGAAGTCTGTTTCCACACCTGTCTCAGCCCAGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGAT
TGATGACCAAAAGAACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGACTGCCTTTACCTCCACCT
GTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGCA
CCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTCAA
TGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGAAGAACTTGCATTGATAAATACCCAAGCTCTT
TTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTT
CAGAAGATTATCTCAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCCCAGGC
CAGTACGGAAGAATGTGAGAAAAATAAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCA
AAGGCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACAC
ATTAGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGC
AAAAATCGTTTTGCCCGATTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAA
TTTATTAACTAATCAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTG
AGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATAGGGAGACCCC
CATCTTTACAAAGAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTA
TTATTTTACAAGTGAAATAAACATACCATTTTCTTTTAGATTGTGTCATTAAATGGAATGAGGTCTCTTA
GTACAGTTATTTTGATGCAGATAATTCCTTTTAGTTTAGCTACTATTTTAGGGGATTTTTTTTAGAGGTA
ACTCACTATGAAATAGTTCTCCTTAATGCAAATATGTTGGTTCTGCTATAGTTCCATCCTGTTCAAAAGT
CAGGATGAATATGAAGAGTGGTGTTTCCTTTTGAGCAATTCTTCATCCTTAAGTCAGCATGATTATAAGA
AAAATAGAACCCTCAGTGTAACTCTAATTCCTTTTTACTATTCCAGTGTGATCTCTGAAATTAAATTACT
TCAACTAAAAATTCAAATACTTTAAATCAGAAGATTTCATAGTTAATTTATTTTTTTTTTCAACAAAATG
GTCATCCAAACTCAAACTTGAGAAAATATCTTGCTTTCAAATTGGCACTGATT]
[[Help! I can't do a BLAST right now.]]This is correct!
The normal BRCA2 gene has a much larger sequence. All human BRCA2 genes obtained from the BLASTn using the sequence have a query coverage of 59% at most, this indicates that a large part of Eva’s BRCA2 gene is missing. Such a big deletion can have huge consequences for the function of the protein.
[[Let's move on -> Epigenetic mutations]]This is incorrect.
Compare the size of the BRCA2 gene to the unknown sequence again. Tip: you can use BLASTn or the NCBI database for this.
[[Go back-> BRCA2 gene mutation]] This is incorrect.
There is no point mutation. Compare the size of the BRCA2 gene to the unknown sequence and check the query coverage again. Tip: you can use BLASTn or the NCBI database for this.
[[Go back-> BRCA2 gene mutation]] This is incorrect.
There is no point mutation. Compare the size of the BRCA2 gene to the unknown sequence and check the query coverage again. Tip: you can use BLASTn or the NCBI database for this.
[[Go back-> BRCA2 gene mutation]] This is incorrect.
There is no point mutation. Compare the size of the BRCA2 gene to the unknown sequence and check the query coverage again. Tip: you can use BLASTn or the NCBI database for this.
[[Go back-> BRCA2 gene mutation]] Aside from mutations in the DNA sequence of the gene itself, epigenetic mutations may also influence the development of cancer cells. Down below a few examples of epigenetic and other mutations are given. Select the examples that can lead to cancer development.
(set: $Hyperactivity to 'false')(set: $Misfolding to 'false')(set: $Insertioninsulator to 'false')(set: $Deletionpromoter to 'false')(set: $Amplification to 'false')(set: $Overexpressionrepressor to 'false')(set: $Mutatedacetyltransferase to 'false')
(checkbox: 2bind $Hyperactivity, "Hyperactivity of the histone methyltransferase.")
(checkbox: 2bind $Misfolding, "Misfolding of the chromatin remodeling complex.")
(checkbox: 2bind $Insertioninsulator, "Insertion of an insulator in between an enhancer and a tumor suppressor gene.")
(checkbox: 2bind $Deletionpromoter, "Deletion of a proto-oncogene promoter.")
(checkbox: 2bind $Amplification, "Amplification of a proto-oncogene through gene copies." )
(checkbox: 2bind $Overexpressionrepressor , "Overexpression of a tumor suppressor gene repressor.")
(checkbox: 2bind $Mutatedacetyltransferase, "Mutated histone tails in a proto-oncogene which prevent the binding of histone acetyltransferase." )
[[check your answer -> check answer 7]]
(if: $Hyperactivity is true and $Misfolding is true and $Insertioninsulator is true and $Deletionpromoter is false and $Amplification is true and $Overexpressionrepressor is true and $Mutatedacetyltransferase is false )[This is the correct combination!
Hyperactivity of the histone methyltransferase will cause methylation of histone tails even on genes which are supposed to be active. This can cause heterochromatin formation on genes that are necessary and inactivate them, like tumor suppressor genes, which may lead to cancer.
The chromatin remodeling complex can modify the nucleosome structure in order to make DNA accessible, misfolding this protein will lead to it losing its function. This mutation can prevent transcription initiation of genes, including tumor suppressor genes, and this may lead to cancer development.
Inserting an insulator between the enhancer and a tumor suppressor gene will block the influence of the enhancer on the gene. This will prevent the transcription of the tumor suppressor gene and may lead to cancer.
Deleting the promoter of a proto-oncogene will ensure less expression of the gene. Because the gene in question is a proto-oncogene, only an increased expression might lead to cancer. If the gene were a tumor suppressor gene, a deletion of the promoter could cause cancer. This mutation will certainly give cell problems, but cancer development is unlikely.
Through amplification of a proto-oncogene the expression will increase. This can lead to cancer development.
Overexpression of a gene repressor will result in less expression of that gene. In this case, the gene is a tumor suppressor gene thus less expression results in a higher chance of the cell developing into a tumor cell.
Histone acetyltransferase binds acetyl to the histone tails. This will open up the nucleosome structure and form euchromatin. Euchromatin formation causes the DNA to be more accessible, and thus it can be transcribed. Losing the ability to bind acetyl on the histones will prevent the cell from transcribing genes. The gene in this example is a proto-oncogene, while this mutation will not be beneficial for the cell, it won’t be likely to cause cancer. Most likely, the histones on that gene will be replaced with normally functioning ones.
[[You're on a roll, next question! ->BRCA2 function]]]
(else:)[This is incorrect. Hint: There are 5 correct answers, [[try again! -> Epigenetic mutations]]
(set: $epigenetics to it +1)
(if: $epigenetics is 5)[If you've tried but couldn't find the right answer, you have the possibility to [[skip]] this question.]]
What is the function of BRCA2 in a normal cell?
1. [[BRCA2 ensures that cells can attach to each other. ->option5.1]]
2. [[BRCA2 influences the efficiency of the p53 protein. -> option5.2]]
3. [[BRCA2 plays a role in repairing DNA. -> option5.3]]
Here are the explanations for the correct answers.
Hyperactivity of the histone methyltransferase will cause methylation of histone tails even on genes which are supposed to be active. This can cause heterochromatin formation on genes that are necessary and inactivate them, like tumor suppressor genes, which may lead to cancer.
The chromatin remodeling complex can modify the nucleosome structure in order to make DNA accessible, misfolding this protein will lead to it losing its function. This mutation can prevent transcription initiation of genes, including tumor suppressor genes, and this may lead to cancer development.
Inserting an insulator between the enhancer and a tumor suppressor gene will block the influence of the enhancer on the gene. This will prevent the transcription of the tumor suppressor gene and may lead to cancer.
Deleting the promoter of a proto-oncogene will ensure less expression of the gene. Because the gene in question is a proto-oncogene, only an increased expression might lead to cancer. If the gene were a tumor suppressor gene, a deletion of the promoter could cause cancer. This mutation will certainly give cell problems, but cancer development is unlikely.
Through amplification of a proto-oncogene the expression will increase. This can lead to cancer development.
Overexpression of a gene repressor will result in less expression of that gene. In this case, the gene is a tumor suppressor gene thus less expression results in a higher chance of the cell developing into a tumor cell.
Histone acetyltransferase binds acetyl to the histone tails. This will open up the nucleosome structure and form euchromatin. Euchromatin formation causes the DNA to be more accessible, and thus it can be transcribed. Losing the ability to bind acetyl on the histones will prevent the cell from transcribing genes. The gene in this example is a proto-oncogene, while this mutation will not be beneficial for the cell, it won’t be likely to cause cancer. Most likely, the histones on that gene will be replaced with normally functioning ones.
[[Next question ->BRCA2 function]] This is incorrect, try looking it up.
[[Go back ->BRCA2 function]] This is incorrect, try looking it up.
[[Go back ->BRCA2 function]] This is correct!
BRCA2 plays a role in repairing double stranded DNA breaks.
[[Next question -> BRCA2: Onco‐ vs tumor suppressor gene]]BRCA2 plays a role in repairing double stranded DNA breaks. So BRCA2 is a(n):
1. [[Tumor suppressor gene -> option6.1]]
2. [[Oncogene -> option6.2]]
3. [[Proto-oncogene -> option6.3]]
This is correct!
If you want to practice the differences between these terms click [[here ->Defenition onco‐ vs tumor suppressor genes]]. And if you’re confident in your abilities,[[you can move on. ->Treatment BRCA2]] This is incorrect.
Let’s try tackling these terms with some more [[practice->Defenition onco‐ vs tumor suppressor genes]]. This is incorrect.
Let’s try tackling these terms with some more [[practice->Defenition onco‐ vs tumor suppressor genes]]. Combine the right term with its definition.
A. Genes in which a gain-of-function mutation can drive a cell toward cancer.
B. Mutated proto-oncogenes that cause the overexpression or overactivation of a gene that stimulates tumor development.
C. Genes in which a loss-of-function mutation can contribute to cancer.
1. Tumor suppressor genes (dropdown: 2bind$supressor, '-', 'A', 'B', 'C')
2. Proto-oncogenes (dropdown: 2bind$proto, '-', 'A', 'B', 'C')
3. Oncogenes (dropdown: 2bind$onco, '-', 'A', 'B', 'C')
[[Check your answer -> check answer 8]]
(if: $supressor is 'C' and $proto is 'A' and $onco is 'B')[That is the correct combination!
[[Let's move on! -> β-catenin: Onco‐ vs tumor suppressor gene]]]
(else:)[That is not the right combintation. [[Try once more. ->Defenition onco‐ vs tumor suppressor genes]]]<img src= 'https://www.frontiersin.org/files/Articles/478145/fimmu-10-02135-HTML/image_m/fimmu-10-02135-g001.jpg' />
(text-style:"italic","subscript")+ (text-color: gray)[β-catenin pathway.^^17^^]
Due to a mutation, β-catenin continuously remains stable. What type of gene is the mutated β-catenin gene?
1. [[An oncogene. -> option 7.1]]
2. [[A tumor suppressor gene. -> option 7.2]]
3. [[A proto-oncogene. -> option 7.3]]
This is correct! If β-catenin remains stable, the mutation is a gain-of-function mutation. This results in overexpression of the Wnt target genes which will lead to uncontrolled cell growth and proliferation. This, of course, might cause tumor development. Thus, the mutated β-catenin gene is an oncogene. [[Next->Treatment BRCA2]]
This is incorrect.
It is not a loss of function mutation, let’s look at the activity of β-catenin again.
[[Try again -> β-catenin: Onco‐ vs tumor suppressor gene]]
This is incorrect.
The normal β-catenin is indeed a proto-oncogene, but the mutated β-catenin isn’t.
[[Let’s try again -> β-catenin: Onco‐ vs tumor suppressor gene]] Now that we know what type of cancer Eva has, we can start her treatment. Fortunately, ER+ PR+ breast cancer is relatively easy to treat. The doctor is very optimistic that Eva can be cured.
Search the internet for the most likely treatment to cure Eva’s type of breast cancer. Please use all lowercase.
(input-box:2bind $BRCA22, 1)
[[check your answer -> check answer 9]](if: $BRCA22 is 'hormone therapy'or 'hormone therapy drugs')[Yes, that is correct!
Eva’s breast cancer possesses estrogen (ER+) and progesterone (PR+) receptors. Estrogen and progesterone both play a part in stimulating the growth and proliferation of cancer cells. Using hormone therapy, the hormone levels can be lowered and/or the receptors can be blocked.
[[Next ->Metastasis of cells (with e-cadherin)]]]
(else:)[This is incorrect. [[Try again ->Treatment BRCA2]]
(set: $BRCAtreatment to it +1)
(if: $BRCAtreatment is 3 or 4 or 5 or 6 or 7 or 8)[Try searching (link: "this site")[(open-url: 'https://www.cancer.org/cancer/types/breast-cancer/understanding-a-breast-cancer-diagnosis/breast-cancer-hormone-receptor-status.html')]. Look for the heading: What do the hormone receptor test results mean?]]
Good news! Eva’s breast cancer disappeared, her treatment has been successful. To say that she has been completely cured, however, might be too soon. Cancer has the unfortunate ability to return in the same or other tissues after a seemingly successful treatment. This is usually due to metastasis, a phenomenon where cancer cells move to other tissues. With breast cancer, metastases in the lungs, liver and even bones are quite common. So to prevent possible tumors in other tissues as a result of metastasis, Eva has to return to the hospital for regular checkups.
Metastasis is a hallmark for cancer. It is something normal cells don’t do. Choose the right words in the blank spaces. Tip: Read// The Changes in Tumor Cells That Lead to Metastasis Are Still Largely a Mystery// on page 1197 in Molecular Biology of the Cell 7^^th^^ edition.
Cancer cells undergo an (dropdown: 2bind$EMT1, '-', 'epithelial-mesenchymal transition', 'epithelial', 'mesenchymal', 'adhesion molecules'). In this process (dropdown: 2bind$EMT2, '-', 'epithelial-mesenchymal transition', 'epithelial', 'mesenchymal', 'adhesion molecules') cancer cells can gain a (dropdown: 2bind$EMT3, '-', 'epithelial-mesenchymal transition', 'epithelial', 'mesenchymal', 'adhesion molecules') phenotype which allows them to escape their tissue. This phenotype is caused by a change in expression of (dropdown: 2bind$EMT4, '-', 'epithelial-mesenchymal transition', 'epithelial', 'mesenchymal', 'adhesion molecules'). For example, e-cadherin expression is
(dropdown: 2bind$EMT5, '-', 'higher', 'lower') in cancer cells. This (dropdown: 2bind$EMT6, '-', 'reduces', 'increases') their adhesion to surrounding cells and allows for them to escape. The cells can then enter the badly made capillary formed during angiogenesis.
[[Check your answer -> check answer 10]]
(if: $EMT1 is 'epithelial-mesenchymal transition' and $EMT2 is 'epithelial' and $EMT3 is 'mesenchymal' and $EMT4 is 'adhesion molecules' and $EMT5 is 'lower' and $EMT6 is 'reduces')[This is correct!
Cancer cells undergo an //epithelial-mesenchymal transition//. In this process //epithelial// cancer cells can gain a //mesenchymal// phenotype which allows them to escape their tissue. This phenotype is caused by a change in expression of //adhesion molecules//. For example, e-cadherin expression is //lower// in cancer cells. This //reduces// their adhesion to surrounding cells and allows for them to escape. The cells can then enter the badly made capillary formed during angiogenesis.
[[The next question ->Cancer cells escape and invate]]]
(else:)[This is incorrect. [[Try again! ->Metastasis of cells (with e-cadherin)]]]What is different in cancer cells that allow for them to escape from their tissue and invade others, while their healthy counterparts can’t? Choose the right option(s).
[(set: $Lessadhesionexpression to false)(set: $Redblood to false)(set: $Bloodstream to false)]
(checkbox: 2bind $Lessadhesionexpression, "Cancer cells have less expression of adhesion genes than normal cells.")
(checkbox: 2bind $Redblood, "Cancer cells can bind red blood cells to hitch-hike, while normal cells can’t.")
(checkbox: 2bind $Bloodstream, "Cancer cells can survive in the bloodstream, whereas normal cells undergo apoptosis.")
[[Check your answer -> check answer 11]]
(if: $Lessadhesionexpression is true and $Redblood is false and $Bloodstream is true)
[This is correct!
As previously discussed, cancer cells have a different expression of adhesion molecules. This removes their contact inhibition, which normal cells still possess. While it is true that many cancer cells die in the bloodstream because of white blood cells or the velocity of the blood, they don’t undergo apoptosis, allowing the small surviving percentage to adhere to other tissue. Normal epithelial cells would undergo apoptosis when they enter the bloodstream.
[[Next question -> Micrometastases and a PET-CT scan]]]
(else:)[This is incorrect.
Hint: There are 2 right options. [[Try again ->Cancer cells escape and invate]]]
Met dank aan Neal voor het feedback geven en testen van deze game!Met dank aan Koen die voor ons de game heeft getest.The image below can give a better idea of what tumors can look like. Tumor development in the left breast of the patient is clearly visible (black in the left-most images and orange in the right-most images). There are also metastases visible in the lymph nodes, sternum and liver.^^9^^
In this image tumors are visualized using a PET-CT scan. Cancer cells that migrate from the tumor into other tissues can form dormant [[micrometastases]]. Is it possible to identify these micrometastases with a PET-CT scan?
<img src= https://media.springernature.com/full/springer-static/image/art%3A10.1007%2Fs40336-021-00426-z/MediaObjects/40336_2021_426_Fig3_HTML.jpg?as=webp, width=612>
(text-style:"italic","subscript")+ (text-color: gray)[PET-CT scan of a patient.^^15^^]
1. [[No, the dormant micrometastases are too small to be detected. -> option 8.1]]
2. [[No, the dormant micrometastases don’t absorb fluorodeoxyglucose. -> option 8.2]]
3. [[Yes, the dormant micrometastases have the same metabolic properties as the tumor. -> option 8.3]]
4. [[Yes, the dormant micrometastases place themselves in between tissues in an abnormal way. -> option 8.4]]
This is incorrect.
This shouldn’t affect the ability to identify tumor cells using fluorodeoxyglucose.
[[Try again -> Micrometastases and a PET-CT scan]] This is correct!
PET-CT scans are unable to detect tumor lumps smaller than 10 mm. Dormant micrometastases are very small, sometimes even consisting of one singular cell, and this makes them very hard to detect. These metastases are often not noticed when checking patients. Years after a patient has been declared cancer-free, these dormant micrometastases can activate and thus can result in returning cancer.
[[Next question ->Angiogenesis by metastasis]]
This is incorrect.
They still have the same metabolism as other tumorcells.
[[Try again -> Micrometastases and a PET-CT scan]]
This is incorrect.
While this is true, not a lot fluorodeoxyglucose can be absorbed by the micrometastasis.
[[Try again -> Micrometastases and a PET-CT scan]]
Tumors, and its metastases, are in need of a lot of nutrients and other supplements to keep up their fast-growing lifestyle. To achieve this, the tumor cells manipulate their environment to a so-called tumor microenvironment (TME) using healthy cells. Part of this TME consists of constructing new blood vessels for nutrient transport.
This process is called: (input-box:2bind $angio, ' ',1)
The newly formed capillaries are often badly made. Together with a loss of cell adhesion this results in: (input-box:2bind $metastais,' ' ,1)
Please use all lowercase.
[[check your answer -> check answer 13]]
Micrometastases occur when tumor cells migrate to other tissues through the lymphovascular system. These metastases are quite small, only consisting of a few cells.
For more information (link: "click here!")[(open-url: 'https://www.verywellhealth.com/micrometastasis-429991')]
[[Go back -> Micrometastases and a PET-CT scan]] (if:$angio is 'angiogenesis' and $metastais is 'metastasis')[This is correct!
Tumors, and its metastases, are in need of a lot of nutrients and other supplements to keep up their fast-growing lifestyle. To achieve this, the tumor cells manipulate their environment to a so-called tumor microenvironment (TME) using healthy cells. Part of this TME consists of constructing new blood vessels for nutrient transport. This process is called //angiogenesis//. The newly formed capillaries are often badly made. Together with a loss of cell adhesion this results in //metastasis//.
[[Next question ->Tumor grow needed supplements]] ]
(else:)[This is incorrect, [[try again ->Angiogenesis by metastasis]] (set: $angiomet to it +1)
(if: $angiomet is 5 or 6 or 7 or 8) [If you've tried but couldn't find the answer, you can [[skip->Tumor grow needed supplements]] this question. The correct answers were (text-colour:#ffadff)[angiogenesis] and (text-colour:#ffadff)[metastasis].
Tumors, and its metastases, are in need of a lot of nutrients and other supplements to keep up their fast-growing lifestyle. To achieve this, the tumor cells manipulate their environment to a so-called tumor microenvironment (TME) using healthy cells. Part of this TME consists of constructing new blood vessels for nutrient transport. This process is called //angiogenesis//. The newly formed capillaries are often badly made. Together with a loss of cell adhesion this results in //metastasis//. ]]
What does a growing tumor require?
[(set: $Oxygensupply to false)(set: $Oxygendisposal to false)(set: $Carbondioxidesupply to false) (set: $Carbondioxidedisposal to false)(set: $Growthfactors to false)(set: $Glucosesupply to false)(set: $Glucosedisposal to false)(set: $Angiogenesisfactors to false)]
(checkbox: 2bind $Oxygensupply, "Oxygen supply")
(checkbox: 2bind $Oxygendisposal, "Oxygen disposal")
(checkbox: 2bind $Carbondioxidesupply, "Carbon dioxide supply")
(checkbox: 2bind $Carbondioxidedisposal, "Carbon dioxide disposal")
(checkbox: 2bind $Growthfactors, "Growth factors")
(checkbox: 2bind $Glucosesupply, "Glucose supply")
(checkbox: 2bind $Glucosedisposal, "Glucose disposal")
(checkbox: 2bind $Angiogenesisfactors, "Angiogenesis factors")
[[Check your answer -> check answer 14]]
(if: $Oxygensupply is true and $Oxygendisposal is false and $Carbondioxidesupply is false and $Carbondioxidedisposal is true and $Growthfactors is true and $Glucosesupply is true and $Glucosedisposal is false and $Angiogenesisfactors is true)[This is the correct combination!
[[Next question -> Romy and Melissa on checking themselfs for breast cancer]]]
(else:)[This is incorrect. There are 5 correct options. [[Try again! ->Tumor grow needed supplements]](set: $supp to it +1)
(if: $supp is 5 or 6 or 7 or 8) [If you've tried but couldn't find the answer, you can [[skip-> Romy and Melissa on checking themselfs for breast cancer]] this question. The correct answers were (text-colour:#ffadff)[Oxygen supply, Carbondioxide disposal, Growth factors, Glucose supply] and (text-colour:#ffadff)[Angiogenesis factors].]]
At Christmas, Eva tells her whole breast cancer journey to her family. She is happy to share the good news with them and her relatives congratulate her on being cancer-free. Her daughter Melissa, who studies biology and is intrigued by the topic, is interested in the details and asks her mother if she knows which type of cancer she had. Happy to see her daughter so immersed, Eva tells her about the mutated BRCA2 gene the lab identified.
“Oh,” Melissa says a bit more seriously. “Then I should probably let myself get checked too.” Eva’s sister, Romy, joins the conversation after hearing her statement: “Why would you do that, darling? Do you think you have cancer too?” Melissa shakes her head, “No, that is unlikely. But because mom got sick, it is very likely I could get breast cancer in the future as well. I’d like to catch it as soon as possible, you know.”
"Nonsense!" Romy proclaims slightly amused, “Breast cancer isn’t infectious, you should know that! With all your biology knowledge! The chances of you or I getting breast cancer is just as low as it is for your friends at school.” She hits Melissa’s shoulder playfully to reassure her.
Who do you think Eva should side with?
1. [[Romy. She is right, breast cancer is not infectious. -> option 9.1]]
2. [[Melissa. You should always listen to biology students. -> option 9.2]]
3. [[Romy. Cancer arises when a cell accumulates mutations, therefore it is something that happens based on chance and Melissa has the same chance of it happening as other people her age. -> option 9.3]]
4. [[Melissa. It is possible for Eva’s cancer to be heritable. -> option 9.4]]
This is incorrect.
While it is true that breast cancer is not infectious, that is not the reason why Melissa is concerned.
[[Try again! -> Romy and Melissa on checking themselfs for breast cancer]]
This is correct!
When Eva mentioned the BRCA2 gene, Melissa recognized it from school. She knew it was a tumor suppressor gene and knew that for a mutation in this gene to cause cancer, it would have to be mutated on both alleles. It is thus very likely that Eva already possessed a faulty BRCA2 gene on one allele and developed cancer when the other also gained a mutation. The presence of a mutated allele in her normal genome could mean that her family might have a higher risk of breast cancer through heritage. So it would be smart to get checked as her daughter, because the faulty BRCA2 gene could be passed down to her. For Romy too, it would be smart. Especially because Romy is older, which increases her risk of cancer too.
[[Let's move on -> The end :)]]
This is incorrect.
Although it would be nice if it were true.
[[Try again! -> Romy and Melissa on checking themselfs for breast cancer]]
This is incorrect.
While mutations are largely based on chance, there are a lot of things that can increase or decrease the chance of developing cancer. Smoking cigarettes, for example, can increase the risk of lung cancer. Even genetics can increase or decrease your risk of developing cancer.
[[Try again! -> Romy and Melissa on checking themselfs for breast cancer]] Congratulations! You have finished today's game on cancer. You have successfully helped Eva and her doctor to detect, analyze and cure her cancer. Good job!
We hope this exercise helped clarify the topic of cancer. If you want to learn more about breast cancer and other cancer-specific phenomenons, you can check out our [[references]].
We would like to thank Ron Habets for his guidance throughout the making of this seminar. And we would like to thank Ernestina Hauptfeld for her help with the coding part of the seminar.
Good luck on the upcoming test!
Suzanne Oudshoorn and Tessa van der Leek
You can close the game now!References:
1. Devoogdt N, Xavier C, Hernot S, et al. Molecular imaging using Nanobodies: a case study. Methods Mol Biol. 2012;911:559-567. doi:10.1007/978-1-61779-968-6_35
2. Alberts B, Heald R, Johnson A, et al. Molecular Biology of the Cell.; 2022.
3. Kankerbestrijding K. Uitgezaaide borstkanker. KWF. August 2023. https://www.kwf.nl/pink-ribbon/borstkanker/uitgezaaide-borstkanker.
4. Miklikova S, Trnkova L, Plava J, Bohac M, Kuniakova M, Cihova M. The Role of BRCA1/2-Mutated Tumor Microenvironment in Breast Cancer. Cancers. 2021; 13(3):575. https://doi.org/10.3390/cancers13030575
5. PET-CT-scan | UMC Groningen. umcg.nl. https://www.umcg.nl/-/pet-scan
6. Breast Cancer Biomarkers. ARUP Consult®. https://arupconsult.com/content/breast-cancer
7. Kankerbestrijding K. Overleving van kanker. KWF. August 2023. https://www.kwf.nl/kanker/wat-is-kanker/overleving-van-kanker.
8. Breast Cancer Hormone Receptor status | Estrogen receptor. American Cancer Society. https://www.cancer.org/cancer/types/breast-cancer/understanding-a-breast-cancer-diagnosis/breast-cancer-hormone-receptor-status.html.
9. Groheux D, Hindié E. Breast cancer: initial workup and staging with FDG PET/CT. Clinical and Translational Imaging. 2021;9(3):221-231. doi:10.1007/s40336-021-00426-z
10. Chen H, Huang SC, Zeng Q, et al. A retrospective study analyzing missed diagnosis of lung metastases at their early stages on computed tomography. Journal of Thoracic Disease. 2019;11(8):3360-3368. doi:10.21037/jtd.2019.08.19
11. Mammography. National Institute of Biomedical Imaging and Bioengineering. https://www.nibib.nih.gov/science-education/science-topics/mammography.
12. Aocnp JSM Anp Bc,. An overview of micrometastases in lymph nodes. Verywell Health. April 2022. https://www.verywellhealth.com/micrometastasis-429991.
13. DNA damage and Gene Mutations (2022) Genes and cancer. Available at: https://www.facingourrisk.org/info/hereditary-cancer-and-genetic-testing/hereditary-cancer/genes-and-cancer
14. Gruenzel, A. (2011) The role of E2F3 phosphorylation in RB-mediated tumorigenesis and embryonic development, Handle Proxy. Available at: http://hdl.handle.net/1811/49037
15. Trott, M. (2021) The ras pathway and cancer: Regulation, challenges and therapeutic progress, Cell Science from Technology Networks. Available at: https://www.technologynetworks.com/cell-science/articles/the-ras-pathway-and-cancer-regulation-challenges-and-therapeutic-progress-347806
16. Zhang, D. et al. (2013) Sterigmatocystin-induced DNA damage triggers G2 arrest via an ATM/p53-related pathway in human gastric epithelium GES-1 cells in vitro, PLOS ONE. Available at: https://doi.org/10.1371/journal.pone.0065044
17. Silva-García, O., Valdez-Alarcón, J.J. and Baizabal-Aguirre, V.M. (2019) Wnt/β-catenin signaling as a molecular target by pathogenic bacteria, Frontiers. Available at: https://doi.org/10.3389/fimmu.2019.02135
[[Back -> The end :)]]
↶↷Hello and welcome to this educational game!
Before we begin, we would like to note that this game is about cancer. Besides the theoretical knowledge discussed in your book, some information about the diagnosis, treatment, and prevention of cancer will be discussed. To people who might have experience with cancer, whether that be themselves or someone close to them, it might cause emotional discomfort. We do, however, advise you to give it a try, as it is important to learn about cancer despite it being a terrible disease.
Got it!